Journal: Nucleic Acids Research

Article Title: Adjacent mutations in the archaeal Rad50 ABC ATPase D-loop disrupt allosteric regulation of ATP hydrolysis through different mechanisms

doi: 10.1093/nar/gkz1228

Figure Lengend Snippet: D-loop mutations affects the Mre11 nuclease activity. (A and B) Mre11 exonuclease activity for truncated MR NBD ( A ) and full-length MR ( B ) complexes with various Rad50 mutations. Exonuclease activity was determined with a 29-nt dsDNA containing a 2-AP probe at the second nucleotide from the 3′-end (Exo2) in the presence of 5 mM Mg 2+ (white bars); 1 mM Mn 2+ (gray bars); 1 mM Mn 2+ , 5 mM Mg 2+ and 1 mM ATP (black bars); or 1 mM Mn 2+ , 5 mM Mg 2+ and 1 mM AMP-PNP (red bars). Bars and error bars represent the average and standard deviation of three replicates. ( C ) Mre11 exonuclease activity for full-length MR complexes with various Rad50 mutations. Exonuclease activity was determined with a 29-nt dsDNA containing a 2-AP probe at the eleventh nucleotide from the 3′-end (Exo11) in the presence of 5 mM Mg 2+ (white bars); 1 mM Mn 2+ (gray bars); 1 mM Mn 2+ , 5 mM Mg 2+ , and 1 mM ATP (black bars); or 1 mM Mn 2+ , 5 mM Mg 2+ and 1 mM AMP-PNP (red bars). Bars and error bars represent the average and standard deviation of three replicates. (D and E) Mre11 endonuclease activity for full-length MR ( D ) and MR NBD ( E ) complexes with various Rad50 mutations. Endonuclease activity was measured using the ΦX174 single-stranded plasmid DNA in the absence (No Mn 2+ ) or presence of 1 mM Mn 2+ , 5 mM Mg 2+ and 1 mM ATP. (F and G) DNA end tethering assay for the various mutants in MR ( F ) and MR NBD ( G ) complexes. End tethering was assessed with linearized plasmid DNA in the presence of 2 mM ATP.

Article Snippet: Endonuclease reactions were performed using 1 μg of ΦX174 single stranded virion circular DNA (New England Biolabs) as the substrate in 30 μl reactions.

Techniques: Activity Assay, Standard Deviation, Plasmid Preparation

Journal: Communications Biology

Article Title: Topological DNA-binding of structural maintenance of chromosomes-like RecN promotes DNA double-strand break repair in Escherichia coli

doi: 10.1038/s42003-019-0655-4

Figure Lengend Snippet: RecN topologically binds to DNA. a Electrophoretic mobility shift assays in which RecN (0–1.5 µM) was incubated at 37 °C for 10 min in the presence of the following phiX174-derivative DNA substrates: circular dsDNA (Cds), linear dsDNA (Lds), and circular ssDNA (Css). The samples were analyzed by agarose gel electrophoresis and SYBR Gold staining. b Quantification of the protein-free DNA bands in the gel images shown in a . The amount of free DNA (%) in each sample was normalized to that detected in the absence of RecN. Data represent the mean ± standard deviation of three independent experiments. c RecN (0.5 µM) was incubated at 37 °C for 10 min in the presence of the indicated phiX174-derivative DNA substrates. The RecN–DNA complexes were collected using Co 2+ -conjugated beads, washed in buffer containing 50 or 500 mM KCl, and eluted with SDS–sample buffer. The eluted proteins were analyzed by SDS–PAGE and Coomassie Brilliant Blue (CBB) staining, and the eluted DNA was analyzed by agarose gel electrophoresis and SYBR Gold staining. d Quantification of the intensities of the DNA bands in the agarose gel images shown in c . Data represent the mean ± standard deviation of three independent experiments. e Schematic illustration of DNA release by DNA linearization in f , g . f The RecN–Cds complex was isolated using the same method described above, and then incubated with or without Pst I. The bead (B) and supernatant (S) fractions were prepared and analyzed by agarose gel electrophoresis and SDS–PAGE as described above. Cds and Lds are shown as molecular size markers. g The assay was performed as described for f with the exception that Css annealed to a short oligonucleotide including a Pst I site was used as the substrate. Css and Lss (linear ssDNA) are shown as molecular markers. f , g The asterisks indicate bovine serum albumin derived from the Pst I stock solution

Article Snippet: To generate a Pst I restriction site, a mixture of phiX174 circular ssDNA (CssDNA; New England Biolabs) and an oligonucleotide (174del: 5′ GCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATCGAAGCGCGC 3′) in annealing buffer (50 mM Tris–HCl at pH 7.5, 10 mM MgCl 2 , and 100 mM NaCl) was heated at 60 °C for 30 min and then gradually cooled to 30 °C.

Techniques: Electrophoretic Mobility Shift Assay, Incubation, Agarose Gel Electrophoresis, Staining, Standard Deviation, SDS Page, Isolation, Derivative Assay

Journal: Communications Biology

Article Title: Topological DNA-binding of structural maintenance of chromosomes-like RecN promotes DNA double-strand break repair in Escherichia coli

doi: 10.1038/s42003-019-0655-4

Figure Lengend Snippet: The ssDNA–dsDNA tethering activity of RecN via topological DNA binding. a One-step pull-down assays in which RecN and phiX174 circular dsDNA (Cds) were incubated at 37 °C for 10 min in the presence of DNA-free beads or ssDNA beads. The materials bound to the beads were eluted with SDS–sample buffer. The eluted proteins were analyzed by SDS–PAGE and CBB staining, and the eluted Cds was analyzed by agarose gel electrophoresis and SYBR Gold staining. The lower graph shows the intensities of the Cds bands in the agarose gel image. b Two-step pull-down assays in which RecN was incubated at 37 °C for 10 min in the presence of DNA-free beads or ssDNA beads. The beads were then washed and incubated with Cds as a second substrate. The bead-bound materials were eluted with SDS–sample buffer and analyzed as described above. The lower graph shows the intensities of the Cds bands in the agarose gel image. **ssDNA dissociated from the beads. c Schematic illustration of linear dsDNA (Lds) release by linearization of the captured second Cds in d . d The ternary complex comprising RecN, dsDNA, and ssDNA beads, isolated by the same method as described for b was treated with or without Xho I. The bead (B) and the supernatant (S) fractions were analyzed by agarose gel electrophoresis and SDS–PAGE as described above. Cds and Lds are shown as molecular markers. e Two-step pull-down assays using dsDNA beads, in which RecN was incubated at 37 °C for 10 min in the presence of DNA-free beads or dsDNA beads. The beads were then washed and incubated with Cds as a secondary substrate. The bead-bound materials were analyzed as described above. The lower graph shows the intensities of Cds bands in the agarose gel image. **dsDNA dissociated from the beads. a , b and e Data represent the mean ± standard deviation of three independent experiments

Article Snippet: To generate a Pst I restriction site, a mixture of phiX174 circular ssDNA (CssDNA; New England Biolabs) and an oligonucleotide (174del: 5′ GCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATCGAAGCGCGC 3′) in annealing buffer (50 mM Tris–HCl at pH 7.5, 10 mM MgCl 2 , and 100 mM NaCl) was heated at 60 °C for 30 min and then gradually cooled to 30 °C.

Techniques: Activity Assay, Binding Assay, Incubation, SDS Page, Staining, Agarose Gel Electrophoresis, Isolation, Standard Deviation

Journal: Communications Biology

Article Title: Topological DNA-binding of structural maintenance of chromosomes-like RecN promotes DNA double-strand break repair in Escherichia coli

doi: 10.1038/s42003-019-0655-4

Figure Lengend Snippet: The effect of nucleotides on the DNA-binding activity of RecN. a RecN (0.5 µM) was incubated at 37 °C for 10 min in the presence of phiX174 circular dsDNA (Cds) and the indicated nucleotides (2 mM). The RecN–DNA complex was collected using Co 2+ -conjugated beads, washed in buffer containing 500 mM KCl, and eluted with SDS–sample buffer. The eluted proteins and DNA were analyzed as described for Fig. . b Quantification of the intensities of the Cds bands in the agarose gel image shown in a . c The assay was performed as described for a , with the exception that phiX174 circular ssDNA (Css) was used in place of Cds. d Quantification of the intensities of the Css bands in the agarose gel image shown in c . e The ATPase activity of RecN. RecN (1 µM) was incubated at 37 °C for 60 min in reaction buffer containing 2 mM ATP plus [γ 32 P]-ATP, in the absence or presence of the indicated phiX174-derivative DNA substrates. The ATPase rates (µM ATP hydrolyzed min −1 per µM RecN) were calculated following quantification of the spots of radioactive inorganic phosphate ( 32 Pi) using an image analyzer. f Two-step pull-down assays in the absence or presence of the indicated nucleotides (2 mM). Cds and RecN recovered by the ssDNA beads were analyzed as described for Fig. . **ssDNA dissociated from the beads. g Quantification of the intensities of the Cds bands in the agarose gel image shown in f . b , d , e , and g All graphs show the mean ± standard deviation of three independent experiments

Article Snippet: To generate a Pst I restriction site, a mixture of phiX174 circular ssDNA (CssDNA; New England Biolabs) and an oligonucleotide (174del: 5′ GCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATCGAAGCGCGC 3′) in annealing buffer (50 mM Tris–HCl at pH 7.5, 10 mM MgCl 2 , and 100 mM NaCl) was heated at 60 °C for 30 min and then gradually cooled to 30 °C.

Techniques: Binding Assay, Activity Assay, Incubation, Agarose Gel Electrophoresis, Standard Deviation

Journal: Communications Biology

Article Title: Topological DNA-binding of structural maintenance of chromosomes-like RecN promotes DNA double-strand break repair in Escherichia coli

doi: 10.1038/s42003-019-0655-4

Figure Lengend Snippet: RecN promotes RecA-mediated D-loop formation and DNA strand exchange. a D-loop assays. RecA (2 µM) was incubated for 10 min in the presence of the pUC19-derivative linear ds/ssDNA (probe), and then RecN (1 µM) was added to the reaction mixture, followed by incubation for a further 15 min. The reactions were initiated by adding homologous pUC19 supercoiled circular DNA (target) and then incubated for another 5 min. The samples were analyzed by agarose gel electrophoresis and SYBR Gold staining. b Quantification of the amounts of D-loop products in the gel image shown in a . Data represent the mean ± standard deviation of three independent experiments. c Strand exchange assays. RecA (0.6 µM) was incubated for 10 min in the presence of phiX174 circular ssDNA (Css). The indicated concentrations (0–1.5 µM) of RecN were added to the reaction mixture, followed by incubation for 15 min. Subsequently, ssDNA-binding protein was added and samples were incubated for an additional 10 min. The reactions were initiated by adding homologous phiX174 linear dsDNA (Lds), incubated for 90 min, and then stopped by the addition of stop buffer. The samples were analyzed by agarose gel electrophoresis and SYBR Gold staining. d Quantification of the amounts of nicked circular dsDNA (NC) products in the gel image shown in c . Data represent the mean ± standard deviation of three independent experiments. e Time-course strand exchange experiments. RecA (0.8 µM) was incubated with or without RecN (1 µM). Aliquots were collected at the indicated time points and analyzed as described above. f Quantification of the amounts of NC DNA products in the gel image shown in e . c , e The arrowheads indicate the DNA substrates (Css and Lds) and the resulting products: joint molecules (JM), nicked circular dsDNA (NC), and linear ssDNA (Lss)

Article Snippet: To generate a Pst I restriction site, a mixture of phiX174 circular ssDNA (CssDNA; New England Biolabs) and an oligonucleotide (174del: 5′ GCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATCGAAGCGCGC 3′) in annealing buffer (50 mM Tris–HCl at pH 7.5, 10 mM MgCl 2 , and 100 mM NaCl) was heated at 60 °C for 30 min and then gradually cooled to 30 °C.

Techniques: Incubation, Agarose Gel Electrophoresis, Staining, Standard Deviation, Binding Assay